Conference Session

Capstone Courses and Project Based-Learning

Collection

2014 ASEE Annual Conference & Exposition

Authors

David R. Sawyers Jr., Ohio Northern University

Tagged Divisions

Mechanical Engineering

were significantly lower than the meanresponse for all mechanical engineering courses.This evaluation also included space for free-form responses related to (a) strengths of the course,(b) weaknesses, and (c) suggestions for improvement. Of the twelve responses in part (a), sevenindicated a perceived increase in problem solving ability by the student. Two of the commentsalso mentioned the relationship between the assignments and knowledge gained in previouscourses. Of the nine responses in part b, three indicated that the workload was too heavy, threesuggested that the lectures should be more closely aligned with the analysis problems, and onesuggested more guidance on problem validation. Of the seven responses in part c, three werepositive or

Collection

2014 ASEE Zone 1 Conference

Authors

Carolyn Jean Sher-DeCusatis; Casimer DeCusatis

chains [13]. This book provides detailed instructions on how to build (also known as function graphs) cloud infrastructure, including high level cloud orchestration tools such as Chef and Puppet. Labs for this course provide B. Networking Classes students with experience in building cloud computing The computer engineering curriculum at City Tech allows environments including Infrastructure-as-a-Service (IaaS)students to earn a two year Associate of Applied Science [14]. This prepares students for related work in the SDN labs,(A.A.S.) degree in

Conference Session

Systems Engineering Division Technical Session 2

Collection

2014 ASEE Annual Conference & Exposition

Authors

Mark Ardis, Stevens Institute of Technology; Christina L. Carmen, University of Alabama in Huntsville; Michael Delorme, Stevens Institute of Technology; Eirik Hole, Stevens Institute of Technology (SSE)

Tagged Divisions

Systems Engineering

the top lessons learned by the Dual-Use Ferry student teams. Atthe end of the design effort, a design solution was provided to the customer. The customer wasvery pleased with the resulting effort and stated that future marketplace design efforts would bewelcomed and supported.AcknowledgmentsWe thank the Department of Defense for financial support of the capstone marketplace projectand for technical and logistical support in providing mentors and sponsors. We thank the mentorsand sponsors of the Dual-Use Ferry project for their generous support and guidance. Finally, wethank the students at Stevens Institute and UAH for their hard work on this challenging project.Bibliography 1. B. McGrath, S. Lowes, A. Squires and C. Jurado, SE Capstone

Conference Session

Enhancing the Underrepresented Student Experience

Collection

2014 ASEE Annual Conference & Exposition

Authors

Aaron S. Hunt, West Texas A&M University; Pamela Renee Lockwood, West Texas A&M University; Emily M. Hunt, West Texas A&M University

Tagged Divisions

Minorities in Engineering

scalequantitative study utilizing the instrument developed and tested in the pilot study and followedby a discerning qualitative case study of selected individuals. The expanded study willdetermine if the phenomenon of rapid growth of Hispanic STEM majors is occurring at otherregional institutions and test the hypotheses identified in the pilot as to why this is occurring orin some locations why not. Page 24.577.6 ASEE 2014METHODOLOGYAs with all educational research, the choice of method must be driven by the research questions(R. B. Johnson & Onwuegbuzie, 2004

Conference Session

Ocean and Marine Division Technical Session 1

Collection

2014 ASEE Annual Conference & Exposition

Authors

Robert W. Whalin, Jackson State University; Thomas William Richardson, Coastal Hazards Center of Excellence; Himangshu Shekhar Das, Jackson State University; Donald L Hendon

Tagged Divisions

Ocean and Marine

were reached with respect to the graduate student’s performance onthe project and with respect to the efficacy of the Ike Dike concept. (1). The following graduate student results and conclusions were obtained. (a). Valuable experience was gained working on a real world very high visibility Page 24.25.13 engineering project (a rare opportunity at the M.S. level). (b). Students performed the following tasks: • Set up input data for the CFD simulation. • Analyzed the CFD results (with professorial guidance). • Performed the comparison of Hurricane

Conference Session

Design in Engineering Education Division Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Jianghong (Esther) Tian, Eastern Mennonite University

Tagged Divisions

Design in Engineering Education

electronics prototyping platform. 7. Develop creativity and innovation skills. 8. Work effectively on a team and negotiate group dynamics. 9. Communicate effectively through written reports and oral presentations.The two projects and their implementation are discussed in this section with the course timelinedetailed in Appendix A. The bills of materials for both Projects 1 and 2 are presented in theAppendices B and C, respectively. At the beginning of the semester, I spent four lectures anddiscussions on the design process – a five-stage prescriptive model (problem definition,conceptual design, preliminary design, detailed design, and design communication), managingdesign process, team work, and engineering notebook (the textbook used in

Conference Session

International Division Technical Session 8

Collection

2014 ASEE Annual Conference & Exposition

Authors

Sheryl A. Sorby, Ohio State University; Bill Williams, Setubal Polytechnic Institute; Jose Manuel Nunes Oliveira, Universidade de Aveiro; Gavin Duffy, University of Limerick; Dermot Brabazon P.E., Dublin City University

Tagged Divisions

International

: Universidad Politécnica de Madrid.11. Jesiek, B., Borrego, M., & Beddoes, K. (2010). Advancing global capacity for engineering education research: relating research to practice, policy and industry. European Journal of Engineering Education, 35(2), 117-134.12. Borrego, M., Froyd, J. E., & Hall, T. S., (2010). Diffusion of Engineering Education Innovations: A Survey of Awareness and Adoption Rates in U.S. Engineering Departments. Journal of Engineering Education, 99 (3), 185-207.13. Hazen, B.T., Yun, W., &Sankar, C.S. (2012). Factors that influence dissemination in Engineering Education. IEEE Transactions on Education, 55(3), 384-393

Conference Session

NSF Grantees’ Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Anca L. Sala, Baker College, Flint

Tagged Topics

NSF Grantees Poster Session

Tagged Divisions

Division Experimentation & Lab-Oriented Studies

supported by a National Science FoundationAdvanced Technological Education3 (ATE) Grant. The goals of the grant project are to: a) createand implement a new Associate of Applied Science Photonics and Laser Technology (AAS PLT)program; b) fully equip an Optics and Photonics Laboratory for education and training; c) trainfaculty to teach core courses in the AAS PLT program; d) perform outreach activities to localhigh schools to promote the new program; e) educate 30 or more students or workers by the endof the project.The paper discusses the efforts and activities performed towards achieving the project goals, andthe results and outcomes obtained in the first year of the grant. Activities included convening anAdvisory Board with industry

Conference Session

New Course Development Concepts in ET II

Collection

2014 ASEE Annual Conference & Exposition

Authors

J. William White AIA, Indiana University Purdue University, Indianapolis; Veto Matthew Ray, Indiana University Purdue University, Indianapolis; Dan D. Koo, Indiana University Purdue University, Indianapolis

Tagged Divisions

Engineering Technology

courses at otherinstitutions was difficult to find. “Construction-based” is the operative term here. The vastmajority of text books, courses and educational opportunities are associated with innovation as itrelates to product development. One notable exception was a course designed by renownedconstruction industry researchers C. H. Nam and C. B. Tatum. Nam and Tatum published theirdevelopment and implementation of a construction innovation class for civil engineeringstudents at Stanford University.9 They approached the topic from two perspectives. First, thecourse involved analyzing innovation fundamentals, specifically the process of innovation,including theories, human interaction, cultural influences, and governmental policies. Second,the

Conference Session

Mechanical Division Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Goodarz Ahmadi, Clarkson University

Tagged Divisions

Mechanical Engineering

results for dispersion for the source near the duct centerlineby comparison with the exact solution. Discuss the importance of gravity andBrownian forces for different size particles. Also evaluate the deposition rate ofpanicles for point sources, which are very near the wall (about a=1 mm). (UseFLUENT as well as your own program and compare the results.)b) Uniform Inlet Concentration: For a uniform inlet concentration of particles insize range of 0.01 to 10 micron, evaluated the deposition rate for laminar flowsbetween two parallel plates. Plot the results in term of Schmidt number. (UseFLUENT as well as your own program and compare the results with thoseobtained from the diffusion analysis.)c) Electromagnetic Forces: For the cases studied in

Collection

2014 Fall ASEE Middle Atlantic Section Conference

Authors

Holly T. Frederick

. B. Phase 2 II. STUDENT PROJECT DESCRIPTION The second phase of the project asks students to delve In the Environmental Engineering Program at Wilkes deeper into a chosen area of interest. They may use theirUniversity, students in their junior year are transitioning into initial topic as a baseline or may build on a topic suggested bydesign work for their engineering discipline. The transition is another student. The focus of the second phase is to identifychallenging for students as they move from the classic the problem or concern with the chosen area. The secondproblem solving approach that is found in many

Collection

2014 ASEE Zone 1 Conference

Authors

Nicholas J. Macedo; Tracie L. Ferreira

). TCACACCTTCTAC–3’and Reverse Primer: 5’– TG GTCTCGTGGATACCGCAGATTCCAT–3' used as A B a loading control. The PCR reactions were analyzed by gel electrophoresis and imaged under UV trans- illumination with AlphaEase® FC software from Alpha Innotech. 0 3. Developing an Optimal Protocol for Extraction of RNA HR from a Single Zebrafish Embryo. Embryos were collected at the 4- cell, high (3 hours post fertilization (hpf), and 24 hpf stages of development. The single embryo was homogenized in a tube of 50ul of TRIzol® as

Conference Session

Entrepreneurship & Engineering Innovation Education Session 3

Collection

2014 ASEE Annual Conference & Exposition

Authors

Anthony Joseph, Pace University

Tagged Divisions

Entrepreneurship & Engineering Innovation

incommunication, leadership, and teamwork skills; liberal arts; social and health sciences;economics and business; and cross-cultural studies, having attributes such as “strong analyticalskills, creativity, ingenuity, professionalism, and leadership.” Since engineering is a deeplycreative process and the creative process can be categorized into five levels2: (a) utilize oneexisting object without considering others, (b) choose one out of many objects, (c) make partialchanges to a selected object, (d) develop a new object or completely modify the chosen one, and(e) develop an entirely new intricate system; each of these levels is further subdivided into sixstages ranging from choosing the task to practical implementation2. Transformativetechnological

Conference Session

New ECE Courses

Collection

2014 ASEE Annual Conference & Exposition

Authors

Constance D. Hendrix, USAF Academy; Danial J. Neebel PE, US Air Force Academy; Ryan Jay Silva, U.S. Air Force Academy

Tagged Divisions

Electrical and Computer

surveys are available in Appendices A and B. Additionally, hardcopy surveys werealso provided to students who did not take the new course (45% of EE/CpE seniors). All juniorstook the course during their sophomore year. The seniors had not had the opportunity to take thecourse by the time of our survey. The results showed that goals 3, 4 and 5 of the course were Page 24.16.11met.Survey responses reveal that both juniors and seniors are more comfortable troubleshootinghardware than software. Because they have more experience, seniors reported being slightlymore comfortable reverse engineering than juniors. Figure 3 shows that juniors reported

Conference Session

Design in Engineering Education Division Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Priya Seshadri, Purdue University; Tahira N. Reid, Purdue University, West Lafayette; Joran W. Booth, Purdue University

Tagged Divisions

Design in Engineering Education

engineering graduate students. Global Journal of Engineering Education, 15(1), 2013. 8 Johannes Strobel, Justin Hess, Rui Pan, and Carrie A. Wachter Morris. Empathy and care within engineering: qualitative perspectives from engineering faculty and practicing engineers. Engineering Studies, 5(2):137–159, 2013. 9 C.P. Titus, Carla B. Zoltowski, and William C. Oakes. Work in progress - assessing moral decision making skills in the engineers of 2020. In Frontiers in Education Conference (FIE), 2010 IEEE, pages S3E–1–S3E–2, 2010.10 Donia R Baldacchino. Teaching on spiritual care: the perceived impact on qualified nurses. Nurse education in practice, 11(1):47–53, 2011.11 Peter Salovey and David J Sluyter. Emotional

Conference Session

Topics Related to Civil Engineering Curriculum

Collection

2014 ASEE Annual Conference & Exposition

Authors

Charles E. Riley, Oregon Institute of Technology; Roger V. Lindgren, Oregon Institute of Technology; Sean St. Clair, Oregon Institute of Technology; David K. Thaemert P.E., Oregon Institute of Technology; Matthew Sleep, Oregon Institute of Technology

Tagged Divisions

Civil Engineering

engineering, where a master’s degreeis already a common requirement for employment.Curricular TransitionA side-by-side comparison of previous and revised curricula including the co-terminal option canbe found in Appendix B. The previous BS program satisfied accreditation requirements andserved the needs of students taking the FE exam prior to Spring 2014. The Oregon Tech generaleducation requirements were satisfied: three credits of college-level algebra or higher, nine Page 24.336.6credits of humanities, 12 credits of social science, 18 credits of communication and six credits ofmath/science electives. The faculty referenced the ASCE Body of

Conference Session

Assessment

Collection

2014 ASEE Annual Conference & Exposition

Authors

James Logan Oplinger, Arizona State University; Micah Lande, Arizona State University, Polytechnic campus

Tagged Divisions

Design in Engineering Education

quality due to the interaction and reflection of design groups11.In addition to coupling a simplified DSM illustrates areas where tasks have to be run in series orhave the opportunity to be run in parallel. In Figure 4 tasks B and C have to be run in seriesbecause task C is dependent on task B; however, tasks A and K can be run in parallel becauseneither is dependent on each other, nor are their prerequisites dependent on the other. Theopportunity to run tasks in parallel is used to help speed production rate, a primary task of the Page 24.893.6DSM11.Smith and Eppinger propose an evolution of the DSM called the Sequential Iteration Model14(SIM

Conference Session

Design in Engineering Education Division Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Ang Liu, University of Southern California; Stephen Y. Lu, University of Southern California

Tagged Divisions

Design in Engineering Education

Base, Ohio 45433, June 1981[12] Mills, J. E., & Treagust, D. F. (2003). Engineering education—Is problem-based or project-based learning the answer?. Australasian Journal of Engineering Education, 3, 2-16.[13] Visser, W. (2006). The cognitive artifacts of designing.[14] Nelson, B. A., Wilson, J. O., Rosen, D., & Yen, J. (2009). Refined metrics for measuring ideation effectiveness. Design Studies, 30(6), 737-743.[15] Clevenger, C. M., & Haymaker, J. (2011). Metrics to assess design guidance. Design Studies, 32(5), 431-456.[16] Tate, D., Agarwal, A., & Zhang, L. (2009). Assessing Design Methods for Functional Representation and Concept Generation: Strategies and Preliminary Results. In Proceedings of the 17th

Collection

2014 ASEE Zone 4 Conference

Authors

Carlye Lauff; Joanna Weilder-Lewis; Kevin O'Connor; Daria Kotys-Schwartz; Mark Rentschler

ongoingattempts to reorganize the undergraduate engineering curriculum. Acknowledgements This research was supported by the National Science Foundation (CMMI Grant No. 1355599). Bibliography1. Dym, C.L., Agogino, A.M., Eris, Ozgur,E., Frey, D.D., & Leifer, L.J. (2005). Engineering design thinking, teaching, and learning. Journal of Engineering Education, 95(1), 103-120.2. Ulrich, K. T. (2011). Design: Creation of artifacts in society. Karl T. Ulrich.3. Bucciarelli, L.L. (1994). Designing Engineers. Cambridge MA: MIT.4. Barley, S., and Orr, J. (1997). Between craft and science: Technical work in US settings. Ithaca: Cornell University Press, N.Y.5. Stevens, R., Johri, A., and O’Connor, K. (2013). Professional engineering work. In B

Conference Session

Pedagogical Approaches in Construction Education

Collection

2014 ASEE Annual Conference & Exposition

Authors

Suat Gunhan, University of Texas, San Antonio

Tagged Divisions

Construction

). “Key Competencies for US Construction Graduates: Industry Perspective.” Journal of Professional Issues in Engineering Education & Practice, 138(2), 123-130. 2. Chan, E. H. W., Chan, M. W., Scott, D., Chan, A. T. S. (2002). Educating the 21st Century Construction Professionals. Journal of Professional Issues in Engineering Education and Practice, 128(1), 44-51. 3. Pries, F., Doree, A., van der Veen, B., and Vrijhoef, R. (2004). “The Role of Leaders’ Paradigm in Construction Industry Change.” Construction Management and Economics, 22(1), 7-10. 4. Skipper, C. O., & Bell, L. C. (2006). “Assessment with 360° Evaluations of Leadership Behavior in Construction Project Managers.” Journal of

Conference Session

WIED: Medley

Collection

2014 ASEE Annual Conference & Exposition

Authors

Ahmed Imran, Ajman University of Science & Technology, United Arab Emirates (UAE).; Mohamed Nasor M. Kalil; Fahar Ghalib Hayati, Ajman University of Science & Technology

Tagged Divisions

Women in Engineering

enhanced student retention in both groups. The enhancementwas more for the women group.Further, an important and interesting observation from this study about student attrition suggeststhat early period after admission is decisive for a significant majority of students, irrespective ofgender.Bibliography1. Cech, E., Rubineau, B., Silbey, S., & Seron, C. (2011). Professional role confidence and gendered persistence in engineering, American Sociological Review, 76(5) 641–666.2. Databytes: Female enrollment in engineering undergraduate programs still growing. Connections – newsletter of the American Society for Engineering Education (ASEE), December 2013. (http://www.asee.org) (Last accessed, December 2013

Conference Session

Systems Engineering Division Technical Session 2

Collection

2014 ASEE Annual Conference & Exposition

Authors

Radu F. Babiceanu, Embry-Riddle Aeronautical University

Tagged Divisions

Systems Engineering

Paper ID #9429A ”Software and Systems” Integration Framework for Teaching Require-ments EngineeringRadu F. Babiceanu, Embry-Riddle Aeronautical University Dr. Radu Babiceanu is an Associate Professor with the Department of Electrical, Computer, Software, and Systems Engineering at Embry-Riddle Aeronautical University in Daytona Beach, Florida. He holds a Ph.D. degree in Industrial and Systems Engineering from Virginia Tech, a M.S. in Mechanical Engineer- ing from the University of Toledo, and a B.S. degree in Manufacturing Engineering from the Polytechnic University of Bucharest. His research provides a systems engineering

Conference Session

Innovations in Computer Engineering Courses

Collection

2014 ASEE Annual Conference & Exposition

Authors

Bill D Carroll P.E., University of Texas, Arlington; Shawn N Gieser, University Of Texas At Arlington; David Levine, University of Texas, Arlington

Tagged Divisions

Electrical and Computer

Synchronous Circuits Solder-less Breadboard Exercise 8 Counters FPGA Exercise 9 Processor Control Unit FPGA Term Project TRISC CPU FPGA (a) IDL 800 (b) Take-Home Parts Kit (c) DE1 Figure 2 – Major Equipment Used in the LaboratoryTake home laboratory kits for digital logic courses are not new13,14,15,16. Most of the previoususes of kits were to replace the need for campus-based facilities and/or to allow laboratoryexercises to be assigned as homework. The kits used in the course described herein are intendedto supplement the

Conference Session

WIED: Strategies Beyond the Classroom

Collection

2014 ASEE Annual Conference & Exposition

Authors

Lisa Rae Volpatti, University of Pittsburgh; Cheryl A. Bodnar, University of Pittsburgh; Lauren M. Byland, University of Pittsburgh

Tagged Divisions

Women in Engineering

studies,questions were asked on the senior exit survey. These questions were as follows:1. If you feel that sexual harassment is an issue of concern within an engineering environment (academic, industry, etc.), which of the following topics do you feel are important (check all that apply)? a) How to identify it? b) What to do if you encounter it? c) Which departments or persons to contact for help and/or advice? d) Sexual harassment is not an issue of concern2. Do you feel that further information on how to identify and cope with sexual harassment within engineering may be useful to you as you enter into the workforce? a) Yes b) NoGraduating seniors were contacted for participation in this on-line survey through e-mail

Conference Session

Teaching and Pedagogy Issues in Graduate Education

Collection

2014 ASEE Annual Conference & Exposition

Authors

Justin M. Foley, Applied Physics Program, University of Michigan; Ashley M. Verhoff, Department of Aerospace Engineering, University of Michigan; John J. Pitre Jr., Department of Biomedical Engineering, University of Michigan; Kathleen Marie Ropella, Department of Biomedical Engineering, University of Michigan

Tagged Divisions

Graduate Studies

methods early was beneficial to their workshop. One participantexpressed, “It was something to get the ball rolling ahead of time and start thinking about thingsearly. I think it worked out well.” Furthermore, the practice workshops were found to beeffective at discovering where the instruction was unclear. An instructor explained, They were definitely helpful for people to point out A) the issues with my code [content]… and B) where things get confusing. While you are writing up your notes … it is almost impossible to figure out where things get confusing.If a graduate student familiar with a program became confused during a practice workshop, itacted as a clear indication that an inexperienced audience would likely struggle

Conference Session

Design Across the Curriculum

Collection

2014 ASEE Annual Conference & Exposition

Authors

Karen L. Bollenbach, University of Virginia; Erika D. Powell, University of Virginia; Stephanie L. Moore, University of Virginia; James F. Groves, University of Virginia

Tagged Divisions

Design in Engineering Education

) b)Figure 2 Interactive online instruction. Web-conferencing software, student and faculty microphones, digital inking hardware (e.g., SMART Interactive Whiteboards, Wacom Graphics Tablets), and digital inking software (e.g. PDF Annotator) make it possible to instruct students in classroom settings and online simultaneously. a) The class session as seen on-campus. b) A class session as seen online.The University of Virginia PRODUCED program described here has placed a premium uponsynchronous engagement inside and outside of class sessions. This focus upon real-timeinteraction has several origins:  Since courses in the program mix face-to-face students with online students and offer the

Conference Session

Teaching Statics

Collection

2014 ASEE Annual Conference & Exposition

Authors

Shraddha Sangelkar, Pennsylvania State University, Erie; Omar M. Ashour, Pennsylvania State University; Russell L. Warley, Pennsylvania State University, Erie; Oladipo Onipede Jr., Pennsylvania State University, Erie

Tagged Divisions

Mechanics

getting “R” on the problem (item 1.13). Inaddition, they agreed that there is an inconsistency in grading between the instructors (item1.16), such that one instructor might give an AC for a sign mistake, while the other instructorwould give R for the same mistake. The grading inconsistency, if any, is between AC and R butnot between C and R; which is not actually an issue as long as the instructor can ensure thatstudents get the grades that they deserve on the third try. Page 24.887.13 a) b) Figure 4. Percentages of a) like items, and b) dislike items for the first

Conference Session

Capstone & Senior Design Projects

Collection

2014 ASEE Annual Conference & Exposition

Authors

Joseph A. Morgan, Texas A&M University; Jay R. Porter, Texas A&M University; Kristina Rojdev, NASA; Daniel Carrejo, NASA; Anthony J. Colozza

Tagged Divisions

Engineering Technology

Conference, Reston, 2012.[7] Porter, J.R., Zoghi, B., Morgan, J., Zhan, W., " Product and System Development: Creating a New Focus for anElectronics Engineering Technology Program,” 2012 American Society for Engineering Education Annual Conference, SanAntonio, TX, 2012.[8] Porter, J.R., Morgan, J., Leonard, M.*, "Electronic Product Development Experiences For Undergraduate Students: ANASA Sponsored Example,” 2013 American Society for Engineering Education Annual Conference, Atlanta, GA, 2013.[9] Porter, J., Wright, G., Morgan, J., Zoghi, B., Fink, R., Jung, Y., “Project EVIS: An Example of an Innovative CapstoneProcess,“ 2006 IJME-Intertech Conference, Union, NJ, October, 2006

Conference Session

Liberal Education/Engineering & Society Division Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

William E. Genereux, Kansas State University, Salina

Tagged Divisions

Liberal Education/Engineering & Society

). Experiments with writing in the engineering classroom. In 1997 Page 24.1130.13 Frontiers in Education Conference (pp. 1564–1567). Pittsburgh, PA.12. Gunnink, B., & Bernhardt, K. L. S. (2002). Writing , critical thinking, and engineering curricula. In Proceedings of the 32nd ASEE/IEEE Frontiers in Education Conference (pp. F3H2–F3H7). Boston, MA.13. Garvey, A. (2010). Writing in an upper-level CS course. Proceedings of the 41st ACM technical symposium on Computer science education - SIGCSE ’10, 209. doi:10.1145/1734263.173433714. Hoffman, M. E., Dansdill, T., & Herscovici, D. S. (2006). Bridging writing to

Conference Session

NSF Grantees’ Poster Session

Collection

2014 ASEE Annual Conference & Exposition

Authors

Michael Johnson, Texas A&M University; Xiaobo Peng, Prairie View A&M University; Bugrahan Yalvac, Texas A&M University; Elif Ozturk; Ke Liu, Prairie View A&M University

Tagged Topics

NSF Grantees Poster Session

Tagged Divisions

Division Experimentation & Lab-Oriented Studies

, the leecture was broken b into thhree laboratoory sections. During botthsemesters, two sectio ons were assiigned contex xtual exercisses (either thhroughout orr in onelaboratorry meeting) and a one secttion was a co ontrol that wwas assigned the stylized book exampplefor their self-guided exercise. e Th udent broughht in for the contextual eexercises werre he objects stuphotograaphed. Studen nts were proovided a ruleer to help theem determine the dimenssions of theiirobject. a. b. c. Figure 1. Self--guided