Collection

2014 ASEE Zone 1 Conference

Authors

Carolyn Jean Sher-DeCusatis; Casimer DeCusatis

chains [13]. This book provides detailed instructions on how to build (also known as function graphs) cloud infrastructure, including high level cloud orchestration tools such as Chef and Puppet. Labs for this course provide B. Networking Classes students with experience in building cloud computing The computer engineering curriculum at City Tech allows environments including Infrastructure-as-a-Service (IaaS)students to earn a two year Associate of Applied Science [14]. This prepares students for related work in the SDN labs,(A.A.S.) degree in

Collection

2014 ASEE Zone 1 Conference

Authors

Nicholas J. Macedo; Tracie L. Ferreira

). TCACACCTTCTAC–3’and Reverse Primer: 5’– TG GTCTCGTGGATACCGCAGATTCCAT–3' used as A B a loading control. The PCR reactions were analyzed by gel electrophoresis and imaged under UV trans- illumination with AlphaEase® FC software from Alpha Innotech. 0 3. Developing an Optimal Protocol for Extraction of RNA HR from a Single Zebrafish Embryo. Embryos were collected at the 4- cell, high (3 hours post fertilization (hpf), and 24 hpf stages of development. The single embryo was homogenized in a tube of 50ul of TRIzol® as

Collection

2014 ASEE Zone 1 Conference

Authors

Connor Needham; Jeremy Kacher; Mathias Boyle; Robert Hutchins; Susan Woodard

team to have a fully optimizedmodel that will be presented to the client in order begin full most likely be minor changes that are made in order toscale production. accommodate any changes that will optimize the model more.D. Full Scale Modeling B. Physical and Elemental LoadsThe client proposed that this 3D printing stage only be takenas a small step in moving forward. When considering the The overall weight of the wind turbine will affect theeffects due to small scale modeling where the Reynolds placement on the RWU Campus. Not only will the overallnumber would not be the same, he proposed that we

Collection

2014 ASEE Zone 1 Conference

Authors

Allen S. Guinoo; Joshua A. Stewart; Lin Lin

the temperature of the hot air collector and the output variable is the temperature inside the testing unit. These temperatures are measured by two separate thermocouples and read by the controller. The controller then makes the determination whether to run the exhaust fan to push more hot air into the testing unit and raise the internal temperature. (a) (b) Figure 4: collector

Collection

2014 ASEE Zone 1 Conference

Authors

Frank Caserta; James McCusker; Gloria Ma

indicated thatfirst year students seemed to test low on their ability to calculate one component of a vector.We continued in the fall of 2013. In the second study, we focused on determining whether usingan animated MATLAB solution calculator would quantitatively improve first-year students’performance. The solution calculator was rewritten to animate a rocket flying straight up. It’saltitude was calculated by a laptop computer running the MATLAB application with variouselevation angles chosen by the student. We tested the students on calculating the height of abuilding given a base-line and elevation angle (see diagram in Appendix B).The main idea of this paper is to measure the improvement in first year students’ performancedue to the use of an

Collection

2014 ASEE Zone 1 Conference

Authors

Mohamed A. Ghalib; Yasser S. Abdalla; R. M. Mostafa

Fig.8 illustrates microcontroller signal waveform single phase inverter. generated by simulation at (a) and by experimental at (b). The output of the H-bridge inverter is shown inFigure 9 shows the simulation and the Fig. 11 passed to the step up transformer and theexperimental results of output waveform of the output of the transformer is connected to thefull bridge single phase inverter. The output load through an LC filter to achieve the desiredvoltage of H-bridge

Collection

2014 ASEE Zone 1 Conference

Authors

Gad J. Selig

hypotheses. Typically, these include: amount of demand per price point, cost structure, feasible distribution channel,978-1-4799-5233-5/14/$31.00 ©2014 IEEEcustomer value proposition, repeat sales rates and customer • Key Resourcesretention, preferred features and most compelling benefits. a) Core competencies: Capability and skill thatThe goal of an entrepreneur is to find a repeatable and scalable creates a competitive advantagemodel, and then execute. Execution does require a traditional b) Strategic assets: Anything rare and valuablebusiness plan, operating plans and financial forecasts to raise

Collection

2014 ASEE Zone 1 Conference

Authors

Julie N. Renner; Kathy E. Ayers

(AEM)-based Water Electrolysis Over the past decade it has been b realized that anionFig. 1. Mass titration curves showing extremes of catalysst surface charge. exchange membranes (AEMs) can n be used as a solid state electrolyte, enabling AEM fuel cells c and other devices.7 Based on these results, a technique was exxplored to control Compared to PEMs, the technolog gy is less developed, butthe charge on the catalyst particles. A catallyst lot with

Collection

2014 ASEE Zone 1 Conference

Authors

Thomas Dodson; Nicholas Mattei; Joshua T. Guerin; Judy Goldsmith; Joan M. Mazur

grade of A or B in Introductory they perceived their advising experiences to be. Computer Programming or a grade of A or B in Calculus Explanation System Survey (ESS): After the development II, you are more likely to receive a grade of A or B in of our advising support system we conducted a large user Introduction to Program Design and Problem Solving, study encompassing both target users of our system and the recommended course. domain experts (advisors). In our target user survey we An additional algorithm was added to later iterations of our surveyed 65 students enrolled

Collection

2014 ASEE Zone 1 Conference

Authors

Arafat Abu Mallouh; Khaled M. Elleithy; Ramadhan Mstafa; Adwan Alanazi

signature is positive,forgery. In this case any attempt to alter the signed quantum Alice sends a message to Trend.states or to recover Alice’s private keys and generates a (7) Trend checks those messages by applying Bob’s personal“legal” signature will be detected. information and Trend’s random checking photons Wen and Liu [10], proposed a quantum message signaturescheme without an arbitrator. This scheme has N-pairs M and A. Initialization of the CommunicationM’ of particles that are created by Alice to carry the quantum We assume that the secret keys Kab, Kac, Kbc aremessage. Bob creates N-pairs of particles A and B in EPR distributed for Alice and Bob

Collection

2014 ASEE Zone 1 Conference

Authors

Mohammad Naimur Rahman; Amir Esmailpour

://en.wikipedia.org/wiki/LAN_switching .[6] Kevin J. Baker, Alan Benner, Ray Hoare, and Adolfy Hoisie, “On the Feasibility of Optical Circuit Switching for High Perhormance Computing Systems” SuoerComputing, November 2005.[7] Y. Zhang, P. Chowdhury, M. Tornatore, and B. Mukherjee, “Energy Efficiency in Telecom Optical Networks,” IEEE Communications Surveys and Tutorials, vol. 12, no. 4, pp. 441–458, 2010.[8] Nathan Farrington, George Porter, Sivasankar Radhakrishnan, Hamid Hajabdolali Bazzaz, Vikram Subramanya, Yeshaiahu Fainman, George Papen, and Amin Vahdat, “Helios: A Hybrid Electrical/Optical Switch Architecture for Modular Data Centers”, San diago CA: University of California.[9] Cisco Data Center Interconnect(White Paper

Collection

2014 ASEE Zone 1 Conference

Authors

Samuel Erskine; Hassan Bajwa

ASEE 2014 Zone I Conference, April 3-5, 2014, University of Bridgeport, Bridgpeort, CT, USA. A Survey of Comparison in Classification of Transport Control Protocol for Energy-Efficient Wireless Sensor Network Samuel Erskine Dr. Hassan Bajwa Computer Science and Engineering Computer Science and Engineering University of Bridgeport University of Bridgeport Bridgeport, USA Bridgeport, USA serskine@bridgeport.edu

Collection

2014 ASEE Zone 1 Conference

Authors

Shanon Reckinger; Blanca Aca; Katherine Pitz

students first learned how to operate the equipment. They did observable small-scale features and also shows an example of one test run, and then they conducted all three test cases. A a student photograph taken for that feature. Appendix B GoPro camera was attached to an arm, which rotates with the shows a sample worksheet that students filled out during their tank, so that the flow pattern video could be recorded. Fig. 5 beach observations. In the afternoon, students returned back

Collection

2014 ASEE Zone 1 Conference

Authors

Khaled Almgren; Christian Bach

) consultant vendors, they could have avoided these problems.System Implementation on Organization: Case Study ERP But they were rushing in making the decision.Implementation in Indonesia, there are three types of B. Operational effectsimplementation impacts: individual, workgroup, and In order for a system to operate effectively, it has to beorganizational impacts (Yoon, 2009). implemented very well. The most important factor in the These effects are operational and managerial. Each of success of the project is the implementation phase (Xue, etthese effects could damage organizations severely. These al., 2005).effects bring many issues to organizations. They will be As

Collection

2014 ASEE Zone 1 Conference

Authors

Hao Dong; Xingguo Xiong; Xuan Zhang

clock signal then the output signal scan system splits this clock signal‘s frequency. "ena_1hz" produces a cycle of pulse signal each second. "flash_1hz" produces a 1Hz pulse clock signal Fig. 1. Schematic diagram of crossroads . The special point during the design process is using constant(b) Parameterization concept: the traffic light circuit can be parameter. The

Collection

2014 ASEE Zone 1 Conference

Authors

A.M. Annan; C. M. McLain; M. E. Perham; D. N. Robear; D. J. McLaughlin

last point, the student authors of this paper have already May 2013. [2] B. L. Yoder, “Two Years Later: A longitudinal look at the impact ofprepared and delivered 10 of their re-designed experiment kits engineering ethics education”, 120th ASEE Annual Conference andto Prof. Walter Buchwald of University of Massachusetts, Exposition report, Atlanta, Georgia, June 2013.Boston for use in a new freshman course being offered in the [3] National Research Council, “Educating the engineer of 2020, adapting

Collection

2014 ASEE Zone 1 Conference

Authors

Mohammed-Noor Naher Al-Maghrabi; Ahmed A. Abdou El-Abbasy

with those of static loads. Headquarters provides day-to-day leadership and 2- To help the demonstrator to teach the course of structuralmanagement for NEES network operations and serves as the dynamics and earthquake engineering, easily and withfocal point for all NEES activities including education, exerting less efforts.outreach and training and management of the equipment site 3- To clarify the differences between:operations (research facilities). The NEES hub research cyber a) Free vibrations and forced vibrations. b) Undamped and damped vibrations. c

Collection

2014 ASEE Zone 1 Conference

Authors

Robert A. Hilton

ASEE 2014 Zone I Conference, April 3-5, 2014, University of Bridgeport, Bridgeport, CT, USA. Reverse Engineering the Volcano CAN BUS Framework for Engine Control Unit Programming Robert A. Hilton Department of Electrical and Computer Engineering University of Hartford West Hartford, Connecticut robert.a.hilton.jr@gmail.com Abstract— The goal of this project is to design a combination project is to create a generic programmer that can be used toISO 9141 (K-Line) and CAN BUS

Collection

2014 ASEE Zone 1 Conference

Authors

Richard Mendoza; Brian Stuckman; Anthony Melkonian; Alexander Gilman

ASEE 2014 Zone I Conference, April 3-5, 2014, University of Bridgeport, Bridgeport, CT, USA. A Multidisciplinary Approach to Retrofitting a Vintage Pinball Machine with a Unique Fog Generation System Pinventions Richard Mendoza, Brian Stuckman, Anthony Melkonian, Alexander Gilman School of Engineering Computing & Construction Management Roger Williams University Bristol, RI rmendoza844@g.rwu.edu, bstuckman012@g.rwu.edu, amelkonian017@g.rwu.edu, agilman490@g.rwu.edu Abstract— An

Collection

2014 ASEE Zone 1 Conference

Authors

Wafa Mohamed Elmannai; Khaled Elleithy

of newadvanced communication techniques for efficient underwatercommunication and networking to enhance ocean monitoringand exploration applications. The paper presents various 2-Dand 3-D models that can be used as the basis of futureresearch. Lloret [14] compares a proposed communication system Figure 2: Flowchart of Proposed Model of Wireless Underwater Sensorwith other existing systems. Although the proposal supports Communicationshort communication distances, it provides high data transferrates. It can be used for precision monitoring in applications B. Discrete Fourier Transform (DFT):such as contaminated ecosystems or for

Collection

2014 ASEE Zone 1 Conference

Authors

Melody Baglione

Heating, Ventilation, and AirChiller Plant Concepts Conditioning and Building Management Systems of a High Performance Academic Building,” Proc. of the 2012 ASME International MechanicalPossible Fill-in-the-Blank words (not all words will be used) Engineering Congress and Exposition, Nov. 9-12, Houston, TX, 2012. [9] L. B. Flick, “The meanings of hands-on science,” Journal of Science Atkinson Carnot vapor-compression Rankine ice

Collection

2014 ASEE Zone 1 Conference

Authors

Matthew Baideme P.E.; Cristian Robbins; Jeffrey Starke

. The Execute phase within the performance thread of the B. Execute Phase metacognitive model helps to bridge the actual execution of For the conduct of the debate, students serving in a defined the debate with the audience, peer, and self-assessment thatrole were grouped with the side their role’s viewpoint best was conducted immediately following the debate. Thealigned. This resulted in two respective sides with each assessment tasks were lumped into the execution phasehaving mutually supportive and nuanced viewpoints that because of their importance to the overall main objective ofprovided counterpoints to the opposite side. The instructor

Collection

2014 ASEE Zone 1 Conference

Authors

Edwin R. Schmeckpeper; Mike Kelley; Steve Beyerlein

dimensions of the rubric are then furtherUSA, (corresponding author, 802-485-6295; fax: 802-485-2260; e-mail:EdwinS@ Norwich.edu). divided into the specific areas for scoring shown in Table 1. A Mike Kelley, is an Associate Professor in the Department of Civil and condensed version of the EPSA rubric is included in AppendixEnvironmental Engineering at Norwich University, Northfield, VT, 05663, B. McCormack et al. explored best practices for administeringUSA (e-mail: mkelley@norwich.edu). Steve Beyerlein is a Professor in the Department of Mechanical and using the EPSA rubric6.Engineering at the University of

Collection

2014 ASEE Zone 1 Conference

Authors

Teresa Piliouras; Pui Lam Yu; Kristin Villanueva; Holly Robillard; Yingxin Chen; Michael Berson; Jeanne R. Lauer; Garret Sampel; Daniel Lapinski; Maigh Attre

-school programs.” than light media users. About half (47%) of heavy media • Key Lessons: 1) Students learn by doing and through users say they usually get fair or poor grades (mostly Cs active hands-on participation, 2) Students need freedom or lower), compared to about a quarter (23%) of light to try things that interest them, 3) Students need varied users. Heavy users comprise approximately 21% of the and early exposure to technology to develop proficiency. young people surveyed. They report watching over six- B. Daniel Lapinski, 9th grader, AITE teen (16) hours of media per day. Light users comprise

Collection

2014 ASEE Zone 1 Conference

Authors

Edwin Divakaran Maria Selvaraj; Jeremy Li

ASEE 2014 zone I Conference, April-3-5, 2014, University of Bridgeport, Bridgeport, CT, USA Design of Manufacturing a Part Edwin Divakaran Maria Selvaraj Jeremy (Zheng) Li Department of Mechanical Engineering Department of Mechanical Engineering University of Bridgeport, Bridgeport,CT University of Bridgeport,Bridgeport,CT e-mail: emariase@bridgeport.edu e-mail: Zhengli@bridgeport.eduAbstract: The paper seeks to manufacture a part II. RESEARCH METHODfor mass communication (fig I.2) with low cost, The research concerns with the making aless complication and more quality by

Collection

2014 ASEE Zone 1 Conference

Authors

Joseph Chen; Mark Molnar

Proceedings of 2014 Zone 1 Conference of the American Society for Engineering Education (ASEE Zone 1) Reintroducing Six Sigma DMAIC Processes using a Hands on Approach Joseph C Chen, Ph.D. & PE & Mark Molnar the work force1. Thus it relies on the corporation toAbstract— In recent years industries and colleges have had a implement educational institutions to conduct further traininggreater need for improved six sigma training. Presented in the to their new engineers. One of such additional educationfollowing paper will be an up to date analysis of the

Collection

2014 ASEE Zone 1 Conference

Authors

Ye Zhou; Amir Esmailpour

@unh.newhaven.edu1          aesmailpour@newhaven.edu2 Abstract - In recent years, database management system (DBMS) has become more prominent in the industry due to the staggering amount of structured and unstructured data. Dealing with management of such data is a challenge for DBMSs. According to several surveys, many company engineers choose Hadoop for their premier management system [5], due to its flexibility, ease of management and being open source software. However, more recently, database administrators of big company cite that Hadoop does not always work in their best interest in specific areas of data management. In order to solve big-data problems by providing

Collection

2014 ASEE Zone 1 Conference

Authors

Mohammad H. Hashem; Ahmed A. Al Khawaja; Saleh O. Edhah; Usman I. Hashmi; Al Hareth S. Al Akill

ASEE 2014 Zone I Conference, April 3-5, 2014, University of Bridgeport, Bridgpeort, CT, USA. How Do Academic Issues affect College Students’ Performance? Mohammad H. Hashem, Ahmed A. Al Khawaja, Saleh O. Edhah, Usman I. Hashmi and Al Hareth S. Al Akill Arts and Science Department Petroleum Institute (PI) Abu Dhabi, United Arab Emirates mohashem@pi.ac.ae Abstract— This paper addresses the research conducted by their previous educational experience to the nature ofa group of

Collection

2014 ASEE Zone 1 Conference

Authors

Andrew Grossfield

changes in the variable, x, would −4produce small changes in the variable, y. Figure 1 Pairs of points on a curve may not have the same A simple example of the functions being studied in calculus slopeis a straight line of the form, y = mx + b. Here we areconcerned with how small changes in the horizontal variable, If the curve is smooth then at a fixed point, say P, the ratiox relate to the corresponding changes in

Collection

2014 ASEE Zone 1 Conference

Authors

Chrisna Nguon; N. N. Nagadewate; Kavitha Chandra; Charles Thompson

3 describes the computational model. Section 4 Ωspresents results for scattering from an inviscid fluid (2)ellipsoidal shaped scatterer for varying compressibil- for s = a, b,where k1s = ωs /c0 is the wavenum-ity contrast parameters. ber and G(x, x0 ) is the three-dimensional free-space Green’s function,2 Scattering from Inhomogeneous ejk1s |x−x0 | Media G(x, x0 ) = (3